[English] 日本語
Yorodumi- PDB-8q5i: Structure of Candida albicans 80S ribosome in complex with cephaeline -
+Open data
-Basic information
Entry | Database: PDB / ID: 8q5i | ||||||
---|---|---|---|---|---|---|---|
Title | Structure of Candida albicans 80S ribosome in complex with cephaeline | ||||||
Components |
| ||||||
Keywords | RIBOSOME / Candida albicans / cephaeline | ||||||
Function / homology | Function and homology information yeast-form cell wall / hyphal cell wall / : / pre-mRNA 5'-splice site binding / protein-RNA complex assembly / negative regulation of mRNA splicing, via spliceosome / maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / small-subunit processome / maintenance of translational fidelity / ribosomal small subunit assembly ...yeast-form cell wall / hyphal cell wall / : / pre-mRNA 5'-splice site binding / protein-RNA complex assembly / negative regulation of mRNA splicing, via spliceosome / maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / small-subunit processome / maintenance of translational fidelity / ribosomal small subunit assembly / rRNA processing / cytosolic small ribosomal subunit / large ribosomal subunit / small ribosomal subunit / cytoplasmic translation / 5S rRNA binding / cytosolic large ribosomal subunit / rRNA binding / ribosome / structural constituent of ribosome / translation / ribonucleoprotein complex / cell surface / RNA binding / zinc ion binding / metal ion binding / cytosol / cytoplasm Similarity search - Function | ||||||
Biological species | Candida albicans (yeast) Synthetic construct (others) | ||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.45 Å | ||||||
Authors | Kolosova, O. / Zgadzay, Y. / Stetsenko, A. / Atamas, A. / Guskov, A. / Yusupov, M. | ||||||
Funding support | France, 1items
| ||||||
Citation | Journal: Biopolym Cell / Year: 2023 Title: Structural characterization of cephaeline binding to the eukaryotic ribosome using Cryo-Electron Microscopy Authors: Kolosova, O. / Zgadzay, Y. / Stetsenko, A. / Atamas, A. / Wu, C. / Jenner, L. / Sachs, S.M. / Guskov, A. / Yusupov, M. | ||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 8q5i.cif.gz | 4.1 MB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb8q5i.ent.gz | Display | PDB format | |
PDBx/mmJSON format | 8q5i.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/q5/8q5i ftp://data.pdbj.org/pub/pdb/validation_reports/q5/8q5i | HTTPS FTP |
---|
-Related structure data
Related structure data | 18156MC M: map data used to model this data C: citing same article (ref.) |
---|---|
Similar structure data | Similarity search - Function & homologyF&H Search |
-Links
-Assembly
Deposited unit |
|
---|---|
1 |
|
-Components
-RNA chain , 6 types, 6 molecules 13410Ag
#1: RNA chain | Mass: 1085306.250 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: 1305241335 |
---|---|
#2: RNA chain | Mass: 38943.129 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: X16634.1 |
#3: RNA chain | Mass: 50683.906 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: OQ195134.1 |
#4: RNA chain | Mass: 4461.723 Da / Num. of mol.: 1 / Source method: isolated from a natural source Details: The correct sequence should be GGCAGCAUAGCUCAGUUGGUUAGAGCGUAGGACUCAUAAGCCUAAGGUCACUGGUUCAAUUCCAGUUCUGCUACCA. Like GGCAG - gap - CUGCUACCA Source: (natural) Candida albicans (yeast) |
#46: RNA chain | Mass: 575838.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: XR_002086442.1 |
#76: RNA chain | Mass: 1625.048 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Synthetic construct (others) |
+60S ribosomal protein ... , 37 types, 37 molecules jklmnopqrstuvyz025678AAABACADAEAFAGAHAJ...
-Ribosomal protein ... , 10 types, 10 molecules wx9AIDEGKVY
#18: Protein | Mass: 22685.850 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ56 |
---|---|
#19: Protein | Mass: 21002.861 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BUG0 |
#28: Protein | Mass: 14215.550 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F3X2 |
#37: Protein | Mass: 14118.759 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F6B7 |
#49: Protein | Mass: 26917.314 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ90 |
#50: Protein | Mass: 27313.570 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYS1 |
#52: Protein | Mass: 25319.922 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BS29 |
#56: Protein | Mass: 21765.146 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1X2 |
#66: Protein | Mass: 13366.540 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYJ9 |
#69: Protein | Mass: 16000.784 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0V0 |
+40S ribosomal protein ... , 23 types, 23 molecules BCFHIJLMOPQRSTUWXZbcdef
-Non-polymers , 6 types, 1545 molecules
#77: Chemical | ChemComp-SPK / | ||||||||
---|---|---|---|---|---|---|---|---|---|
#78: Chemical | #79: Chemical | ChemComp-SPD / | #80: Chemical | ChemComp-MG / #81: Chemical | ChemComp-ZN / #82: Water | ChemComp-HOH / | |
-Details
Has ligand of interest | Y |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-Sample preparation
Component | Name: Candida albicans 80S ribosome in complex with cephaeline Type: RIBOSOME / Entity ID: #1-#75 / Source: NATURAL |
---|---|
Molecular weight | Experimental value: NO |
Source (natural) | Organism: Candida albicans (yeast) |
Buffer solution | pH: 7.5 |
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
Vitrification | Cryogen name: ETHANE |
-Electron microscopy imaging
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
Electron lens | Mode: BRIGHT FIELDBright-field microscopy / Nominal defocus max: 2400 nm / Nominal defocus min: 900 nm |
Image recording | Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-Processing
EM software | Name: PHENIX / Version: 1.19rc4_4035: / Category: model refinement | ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
3D reconstruction | Resolution: 2.45 Å / Resolution method: FSC 3 SIGMA CUT-OFF / Num. of particles: 254047 / Symmetry type: POINT | ||||||||||||||||||||||||
Refine LS restraints |
|