[English] 日本語
Yorodumi- PDB-4v7d: Structure of the Ribosome with Elongation Factor G Trapped in the... -
+Open data
-Basic information
Entry | Database: PDB / ID: 4v7d | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Structure of the Ribosome with Elongation Factor G Trapped in the Pre-Translocation State (pre-translocation 70S*tRNA*EF-G structure) | |||||||||
Components |
| |||||||||
Keywords | TRANSLATION/antibiotic / translation / EF-G / single particle analysis / pre-translocation translation complex / viomycin / TRANSLATION-antibiotic complex | |||||||||
Function / homology | Function and homology information ribosome disassembly / translational elongation / guanosine tetraphosphate binding / stringent response / mRNA base-pairing translational repressor activity / ornithine decarboxylase inhibitor activity / transcription antitermination factor activity, RNA binding / misfolded RNA binding / Group I intron splicing / RNA folding ...ribosome disassembly / translational elongation / guanosine tetraphosphate binding / stringent response / mRNA base-pairing translational repressor activity / ornithine decarboxylase inhibitor activity / transcription antitermination factor activity, RNA binding / misfolded RNA binding / Group I intron splicing / RNA folding / transcriptional attenuation / endoribonuclease inhibitor activity / RNA-binding transcription regulator activity / positive regulation of ribosome biogenesis / negative regulation of cytoplasmic translation / translation elongation factor activity / translational termination / DnaA-L2 complex / four-way junction DNA binding / translation repressor activity / negative regulation of translational initiation / negative regulation of DNA-templated DNA replication initiation / regulation of mRNA stability / ribosome assembly / mRNA regulatory element binding translation repressor activity / assembly of large subunit precursor of preribosome / positive regulation of RNA splicing / transcription elongation factor complex / response to reactive oxygen species / DNA endonuclease activity / cytosolic ribosome assembly / regulation of DNA-templated transcription elongation / transcription antitermination / regulation of cell growth / maintenance of translational fidelity / DNA-templated transcription termination / Hydrolases; Acting on acid anhydrides; Acting on GTP to facilitate cellular and subcellular movement / response to radiation / mRNA 5'-UTR binding / ribosomal large subunit assembly / ribosomal small subunit biogenesis / ribosomal small subunit assembly / small ribosomal subunit rRNA binding / ribosome binding / large ribosomal subunit / regulation of translation / ribosome biogenesis / cytosolic small ribosomal subunit / large ribosomal subunit rRNA binding / small ribosomal subunit / 5S rRNA binding / transferase activity / cytoplasmic translation / cytosolic large ribosomal subunit / tRNA binding / negative regulation of translation / rRNA binding / molecular adaptor activity / ribosome / structural constituent of ribosome / translation / response to antibiotic / mRNA binding / GTPase activity / negative regulation of DNA-templated transcription / GTP binding / protein homodimerization activity / DNA binding / RNA binding / zinc ion binding / membrane / cytosol / cytoplasm Similarity search - Function | |||||||||
Biological species | Escherichia coli (E. coli) Synthetic (others) Streptomyces (bacteria) | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 7.6 Å | |||||||||
Authors | Brilot, A.F. / Korostelev, A.A. / Ermolenko, D.N. / Grigorieff, N. | |||||||||
Citation | Journal: Proc Natl Acad Sci U S A / Year: 2013 Title: Structure of the ribosome with elongation factor G trapped in the pretranslocation state. Authors: Axel F Brilot / Andrei A Korostelev / Dmitri N Ermolenko / Nikolaus Grigorieff / Abstract: During protein synthesis, tRNAs and their associated mRNA codons move sequentially on the ribosome from the A (aminoacyl) site to the P (peptidyl) site to the E (exit) site in a process catalyzed by ...During protein synthesis, tRNAs and their associated mRNA codons move sequentially on the ribosome from the A (aminoacyl) site to the P (peptidyl) site to the E (exit) site in a process catalyzed by a universally conserved ribosome-dependent GTPase [elongation factor G (EF-G) in prokaryotes and elongation factor 2 (EF-2) in eukaryotes]. Although the high-resolution structure of EF-G bound to the posttranslocation ribosome has been determined, the pretranslocation conformation of the ribosome bound with EF-G and A-site tRNA has evaded visualization owing to the transient nature of this state. Here we use electron cryomicroscopy to determine the structure of the 70S ribosome with EF-G, which is trapped in the pretranslocation state using antibiotic viomycin. Comparison with the posttranslocation ribosome shows that the small subunit of the pretranslocation ribosome is rotated by ∼12° relative to the large subunit. Domain IV of EF-G is positioned in the cleft between the body and head of the small subunit outwardly of the A site and contacts the A-site tRNA. Our findings suggest a model in which domain IV of EF-G promotes the translocation of tRNA from the A to the P site as the small ribosome subunit spontaneously rotates back from the hybrid, rotated state into the nonrotated posttranslocation state. | |||||||||
History |
|
-Structure visualization
Movie |
Movie viewer |
---|---|
Structure viewer | Molecule: MolmilJmol/JSmol |
-Downloads & links
-Download
PDBx/mmCIF format | 4v7d.cif.gz | 3.3 MB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb4v7d.ent.gz | Display | PDB format | |
PDBx/mmJSON format | 4v7d.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/v7/4v7d ftp://data.pdbj.org/pub/pdb/validation_reports/v7/4v7d | HTTPS FTP |
---|
-Related structure data
Related structure data | 5800MC 5796C 5797C 5798C 5799C 4v7cC M: map data used to model this data C: citing same article (ref.) |
---|---|
Similar structure data |
-Links
-Assembly
Deposited unit |
|
---|---|
1 |
|
-Components
-RNA chain , 5 types, 6 molecules AAABBABVBWBX
#1: RNA chain | Mass: 941306.188 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: 33357927 | ||
---|---|---|---|
#2: RNA chain | Mass: 38483.926 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: CP000948.1 | ||
#35: RNA chain | Mass: 499690.031 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: GenBank: J01695.2 | ||
#56: RNA chain | Mass: 24485.539 Da / Num. of mol.: 2 / Fragment: SEE REMARK 999 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: K-12 / References: GenBank: AP009048.1 #57: RNA chain | | Mass: 5781.499 Da / Num. of mol.: 1 / Fragment: SEE REMARK 999 / Source method: obtained synthetically / Source: (synth.) Synthetic (others) |
+50S ribosomal protein ... , 32 types, 32 molecules ACADAEAFAGAHAIAJAKALAMANAOAPAQARASATAUAVAWAXAYAZA1A2A3A4A5A6A7A8
-30S ribosomal protein ... , 20 types, 20 molecules BBBCBDBEBFBGBHBIBJBKBLBMBNBOBPBQBRBSBTBU
#36: Protein | Mass: 26650.475 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V0 |
---|---|
#37: Protein | Mass: 25900.117 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V3 |
#38: Protein | Mass: 23383.002 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7V8 |
#39: Protein | Mass: 17498.203 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W1 |
#40: Protein | Mass: 15211.058 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02358 |
#41: Protein | Mass: 19923.959 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P02359 |
#42: Protein | Mass: 14015.361 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7W7 |
#43: Protein | Mass: 14755.074 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7X3 |
#44: Protein | Mass: 11755.597 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R5 |
#45: Protein | Mass: 13739.778 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7R9 |
#46: Protein | Mass: 13636.961 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S3 |
#47: Protein | Mass: 12997.271 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7S9 |
#48: Protein | Mass: 11475.364 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG59 |
#49: Protein | Mass: 10159.621 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0ADZ4 |
#50: Protein | Mass: 9207.572 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T3 |
#51: Protein | Mass: 9593.296 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0AG63 |
#52: Protein | Mass: 8874.276 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7T7 |
#53: Protein | Mass: 10324.160 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U3 |
#54: Protein | Mass: 9577.268 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P0A7U7 |
#55: Protein | Mass: 8392.844 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / Strain: MRE600 / References: UniProt: P68679 |
-Protein / Protein/peptide / Non-polymers , 3 types, 3 molecules BZBY
#58: Protein | Mass: 78616.203 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Escherichia coli (E. coli) / Strain: K-12 / Gene: fusA / Plasmid: pET24b / Production host: Escherichia coli (E. coli) / Strain (production host): BL21 / References: UniProt: P0A6M8 |
---|---|
#59: Protein/peptide | |
#60: Chemical | ChemComp-ZN / |
-Details
Sequence details | THE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGGUAAAAAUGUUUAAACGUAAAUCUACU) USED IN THIS ...THE SEQUENCES OF P/E TRNA (TRNA-MET) AND MRNA (GGCAAGGAGG |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-Sample preparation
Component |
| ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Value: 3 MDa / Experimental value: NO | ||||||||||||||||||||||||||||||
Buffer solution | Name: Polymix buffer / pH: 7.6 Details: 10 mM HEPES-KOH, 5 mM MgCl2, 90 mM NH4Cl, 2 mM spermidine, 0.1 mM spermine, 6 mM BME, 0.5 mM viomycin, 0.5 mM GTP, 0.5 mM fusidic acid | ||||||||||||||||||||||||||||||
Specimen | Conc.: 0.4 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||||||||
Specimen support | Details: C-flat 1.2/1.3 holey carbon 400 mesh copper grid, glow discharged with a current of -20 mA for 45 seconds in an EMITECH K100X glow discharge unit | ||||||||||||||||||||||||||||||
Vitrification | Instrument: FEI VITROBOT MARK II / Cryogen name: ETHANE / Humidity: 95 % Details: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side ...Details: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane. Method: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side ...Method: Freshly glow-disharged grids were loaded into an FEI Mark II Vitrobot and equilibrated to 95% relative humidity at 22 degrees Celsius. 2 microliters of sample was applied through the side port, blotted for 7 seconds with a positional offset of 2, and plunged into liquid ethane. |
-Electron microscopy imaging
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS / Date: Nov 2, 2012 |
Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
Electron lens | Mode: BRIGHT FIELDBright-field microscopy / Nominal magnification: 133333 X / Calibrated magnification: 134615 X / Nominal defocus max: 6950 nm / Nominal defocus min: 1150 nm / Cs: 0.01 mm / Astigmatism: Automatically corrected using FEI software / Camera length: 0 mm |
Specimen holder | Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER |
Image recording | Electron dose: 30 e/Å2 / Film or detector model: FEI FALCON I (4k x 4k) |
Image scans | Num. digital images: 13341 |
Radiation | Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Relative weight: 1 |
-Processing
EM software |
| ||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Details: CTFFIND3, FREALIGN per micrograph | ||||||||||||||||||||||||||||||||
Symmetry | Point symmetry: C1 (asymmetric) | ||||||||||||||||||||||||||||||||
3D reconstruction | Method: Projection Matching / Resolution: 7.6 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 85115 / Nominal pixel size: 1.05 Å / Actual pixel size: 1.04 Å Details: Refinement included data to 12 Angstrom resolution to limit FSC bias. See primary citation Supplementary Information for details. (Single particle details: Refinement and 3D classification ...Details: Refinement included data to 12 Angstrom resolution to limit FSC bias. See primary citation Supplementary Information for details. (Single particle details: Refinement and 3D classification performed by Frealign) (Single particle--Applied symmetry: C1) Symmetry type: POINT | ||||||||||||||||||||||||||||||||
Atomic model building |
| ||||||||||||||||||||||||||||||||
Atomic model building |
| ||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST
|