3D Electron Microscopy (3D-EM) Data Navigator [English / 日本語]
B. subtilis RNase P RNA Specificity domain folding intermediate
by single particle reconstruction, at 15.2 A resolution
#1: Surface view with section colored by density value, Surface level: 0.0623, Made by UCSF CHIMERA
#2: Surface view colored by radius, Surface level: 0.0623, Made by UCSF CHIMERA
 Entry | |
| Summary | |
| Database / ID | EM DATA BANK (EMDB) / 5242 |
|---|---|
| Title | B. subtilis RNase P RNA Specificity domain folding intermediate |
| Map | This is a map of the folding intermediate of B. subtilis RNase P Specificity domain |
| Sample | B. subtilis RNase P RNA Specificity domain folding intermediate |
| Keywords |  RNA folding intermediate RNase P Specificity domain |
| Authors | Baird NJ, Ludtke SJ, Khant H, Chiu W, Pan T, Sosnick TR |
| Date | Deposition: 2010-10-27, Header release: 2010-12-22, Map release: 2010-12-22, Last update: 2010-12-22 |
| EMDB Sites |  EMDB @PDBe (EU), EMDB @RCSB (USA) |
| Structure Visualization | |
| Movies |  Movie Page#1: Surface view with section colored by density value, Surface level: 0.0623, Made by UCSF CHIMERA #2: Surface view colored by radius, Surface level: 0.0623, Made by UCSF CHIMERA |
| Supplemental images | |
| Structure viewers |  Yorodumi,  Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe) |
| Related Structure Data | |
| Related Entries |
Cite: data citing same article |
| Similar strucutres (beta) |
 List of similar structure data  about Omokage system |
 Article | |
| Citation - Primary | |
| Article | J. Am. Chem. Soc., Vol. 132, Issue 46, Page 16352-3, Year 2010 |
|---|---|
| Title | Discrete structure of an RNA folding intermediate revealed by cryo-electron microscopy. |
| Authors | Nathan J Baird, Steven J Ludtke, Htet Khant, Wah Chiu, Tao Pan, Tobin R Sosnick Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, Illinois 60637, United States. |
| Keywords | Amino Acid Sequence, Bacillus (enzymology), Circular Dichroism, Cryoelectron Microscopy, Models, Molecular, Molecular Sequence Data, Ribonuclease P (chemistry, 3.1.26.5) |
| Links | DOI: 10.1021/ja107492b, PubMed: 21038867, PMC: PMC2988076 |
 Map | |||||||||||||||||||||||||
| File |  EMD-5242.map ( map file in CCP4 format, 16386 KB ) | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Projections & Slices | Size of images:
Images are generated by Spider package. | ||||||||||||||||||||||||
| Density |
| ||||||||||||||||||||||||
| Data Type | Image stored as Reals | ||||||||||||||||||||||||
| Space Group Number | 1 | ||||||||||||||||||||||||
| Map Geometry |
| ||||||||||||||||||||||||
| Unit Cell | A= B= C: 289.6 A Alpha=beta=gamma: 90 degrees | ||||||||||||||||||||||||
| Pixel Spacing | X= Y= Z: 1.81 A | ||||||||||||||||||||||||
| CCP4 map header info | |||||||||||||||||||||||||
| Annotation Details | This is a map of the folding intermediate of B. subtilis RNase P Specificity domain | ||||||||||||||||||||||||
 Supplement |
 Sample | |
| Name | B. subtilis RNase P RNA Specificity domain folding intermediate |
|---|---|
| Number of Components | 1 |
| Oligomeric State | Monomer of Specificity domain |
| Theoretical Mass | 0.05MDa |
| Details | none |
| Mass-estimation Method | Calculation from nucleotide sequence, 154mer RNA |
| Component #1: nucleic-acid - RNase P RNA Specificity domain | |
| Scientific name | RNA |
| Common Name | RNase P RNA Specificity domain |
| Theoretical Mass | 0.05 MDa |
| Scientific Name of Species | Bacillus subtilis
|
| Common Name of Species | Bacteria |
| NCBI taxonomy | 1423 |
| Sequence | GCGAGCCUAGCGAAGUCAUAAGCUAGGGCAGUCUUUAGAGGCUGACGGCA GGAAAAAAGCCUACGUCUUCGGAUAUGGCUGAGUAUCCUUGAAAGUGCCA CAGUGACGAAGUCUCACUAGAAAUGGUGAGAGUGGAACGCGGUAAACCCC UCGC |
| Structure | OTHER |
| Class | RNA |
| Synthetic | No |
 Experiment | |
| Sample Preparation | |
| Specimen Conc | 1 mg/ml |
|---|---|
| Specimen Support Details | 400 mesh carbon grid |
| Specimen State | particle |
| Buffer | Details: 1 mM MgCl2, 20 mM TrisHCl pH 8 pH: 8 |
| Vitrification | |
| Method | 2 blots 1 second each before plunging |
| Cryogen Name | ETHANE |
| Details | Vitrification instrument: FEI Vitrobot mark III |
| Humidity | 100 |
| Instrument | FEI VITROBOT MARK III |
| Temperature | 77 Kelvin |
| Imaging | |
| Microscope | JEOL 2010F |
| Date | 10-MAR-2006 |
| Electron Gun | |
| Electron Source | FIELD EMISSION GUN |
| Accelerating Voltage | 200 kV |
| Electron Dose | 16 e/A**2 |
| Illumination Mode | FLOOD BEAM |
| Lens | |
| Magnification | Nominal: 60000 |
| Astigmatism | object astigmatism correction made at 400,000 times magnification |
| Nominal Cs | 2 mm |
| Imaging Mode | BRIGHT FIELD |
| Defocus | 1000 nm - 3500 nm |
| Specimen Holder | |
| Holder | single tilt cryo-holder |
| Model | GATAN LIQUID NITROGEN |
| Temperature | 94.1 K ( 93 - 95 K) |
| Camera | |
| Detector | Gatan Ultrascan 4000 |
| Image Acquisition | |
| Number of Digital Images | 100 |
 Processing | |
| Method | single particle reconstruction |
|---|---|
| 3D reconstruction | |
| Algorithm | Cross-common lines |
| Software | EMAN |
| Details | FSC gives a resolution of 15.2 A, but the model was low-pass filtered to 26 A, corresponding to the first zero-crossing of the data. CTF correction was not performed. |
| Resolution By Author | 15.2 A |
| Resolution Method | FSC at 0.5 cut-off |
| Single Particle | |
| Number of Class Averages | 60 |
| Number of Projections | 11600 |
| Details | The particles were selected using an automatic selection program and then inspected manually |
| Download | |||
| Data from EMDB | |||
| Header (meta data in XML format) | emd-5242.xml (7.5 KB) | ||
|---|---|---|---|
| Map data | emd_5242.map.gz (14.1 MB) | ||
| FTP directory | ftp://ftp.pdbj.org/pub/emdb/structures/EMD-5242 | ||
| Movie files | |||
| movie #1 |
| ||
| movie #2 |
| ||
Top
Gallery
List
Diagram
Statistics
Documents
PDBj
EM Navigator
Detail page - EMDB-5242
Z (Sec.)
Y (Row.)
X (Col.)
Contact