EMDB-5127: Three-dimensional EM structure of an intact activator-...

Entry
Summary
Database / ID	EM DATA BANK (EMDB) / 5127
Title	Three-dimensional EM structure of an intact activator-dependent transcription initiation complex
Map	E. coli Class I transcription activation complex
Sample	E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Keywords	transcription, initiation, Class I, activator, RNA polymerase, holoenzyme, sigma70, open complex, CAP, CRP, cAMP-dependent, DNA, prokaryotic
Authors	Hudson BP, Quispe J, Lara S, Kim Y, Berman HM, Arnold E, Ebright RH, Lawson CL
Date	Deposition: 2009-07-30, Header release: 2009-08-24, Map release: 2009-11-04, Last update: 2012-05-21
EMDB Sites	EMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
Movies	Movie Page #1: Surface view with section colored by density value, Surface level: 2.8, Made by UCSF CHIMERA #2: Surface view colored by radius, Surface level: 2.8, Made by UCSF CHIMERA #3: Surface view with fitted model, atomic models: PDB-3iyd, Surface level: 2.8, Made by UCSF CHIMERA
Supplemental images	EMDB figure
Structure viewers	Yorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Related Entries	PDB-3iyd CiteFit Cite: data citing same article Fit: output model of fitting
Similar strucutres (beta)	Diagram PDB-3iyd EMDB-5440 EMDB-1929 EMDB-2321 EMDB-5407 List of similar structure data about Omokage system

Article
Citation - Primary
Article	Proc. Natl. Acad. Sci. U.S.A., Vol. 106, Issue 47, Page 19830-5, Year 2009
Title	Three-dimensional EM structure of an intact activator-dependent transcription initiation complex.
Authors	Brian P Hudson, Joel Quispe, Samuel Lara-González, Younggyu Kim, Helen M Berman, Eddy Arnold, Richard H Ebright, Catherine L Lawson Department of Chemistry and Chemical Biology, Rutgers University, 610 Taylor Road, Piscataway, NJ 08854, USA.
Keywords	Base Sequence, Cyclic AMP Receptor Protein (chemistry), DNA, Bacterial (chemistry), DNA-Directed RNA Polymerases (chemistry, 2.7.7.6), Escherichia coli Proteins (chemistry), Macromolecular Substances (chemistry), Models, Molecular, Molecular Sequence Data, Nucleic Acid Conformation, Promoter Regions, Genetic, Protein Structure, Tertiary, Protein Subunits (chemistry), Transcription, Genetic
Links	DOI: 10.1073/pnas.0908782106, PubMed: 19903881, PMC: PMC2775702

Map

File

EMD-5127.map ( map file in CCP4 format, 2050 KB )

Projections & Slices

Size of images:

Axes	Z (Sec.)	Y (Row.)	X (Col.)
Surface
Projections
Slices (1/3)
Slices (1/2)
Slices (2/3)

Images are generated by Spider package.

Density

Histogram

Histogram (log scale)

Contour Level:	2.8 (by author), 2.8 (movie #1):
Minimum - Maximum:	-3.34078479 - 14.39524174
Average (Standard dev.):	0E-8 (0.90271008)

Data Type

Image stored as Reals

Space Group Number

Map Geometry

Axis order	X	Y	Z
Dimensions	80	80	80
Origin	-40	-40	-40
Limit	39	39	39
Spacing	80	80	80

Unit Cell

A= B= C: 371.19998 A
Alpha=beta=gamma: 90 degrees

Pixel Spacing

X= Y= Z: 4.64 A

CCP4 map header info

mode	Image stored as Reals
A/pix X/Y/Z	4.64	4.64	4.64
M x/y/z	80	80	80
origin x/y/z	0.000	0.000	0.000
length x/y/z	371.200	371.200	371.200
alpha/beta/gamma	90.000	90.000	90.000
start NX/NY/NZ	-34	-26	-72
NX/NY/NZ	69	53	145
MAP C/R/S	1	2	3
start NC/NR/NS	-40	-40	-40
NC/NR/NS	80	80	80
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean	-3.341	14.395	-0.000

Annotation Details

E. coli Class I transcription activation complex

Supplement

Sample
Name	E. coli RNA polymerase holoenzyme (sigma70) and E. coli catabolite activator protein (CAP) bound to 98-mer DNA containing the lac promoter and engineered open transcription bubble
Number of Components	3
Oligomeric State	One molecule of RNAP (containing six subunits) and one CAP homodimer bound to a DNA duplex)
Theoretical Mass	0.57MDa
Details	Complex formation was verified by gel shift
Component #1: protein - CAP
Scientific name	Catabolite Activator Protein
Common Name	CAP
Theoretical Mass	0.05 MDa
Oligomeric Details	homodimer
Number of Copies	1
Scientific Name of Species	Escherichia coli
NCBI taxonomy	562
Strain	K12
Recombinant expression	Yes
Engineered Source	NCBI taxonomy: 469008 Expression system: Escherichia coli BL21(DE3) Vector: pET21(a)
Links	Gene Ontology: GO:0006355, Inter Pro: IPR:001808
Component #2: nucleic-acid - lac(ICAP)UP-UV5-bubble
Scientific name	lac(ICAP)UP-UV5-bubble
Theoretical Mass	0.06 MDa
Experimental Mass	0.06 MDa
Details	An engineered 98mer duplex based on positions -78 to 20 of the Class I CAP-dependent promoter lac but containing consensus -10 sequence and consensus binding sites for CAP and RNAP alpha-CTD. Positions -11 to 2 are non-complementary to create an artificial transcription bubble. Top strand 5'-CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACT TTATGCTTCCGGCTCGTATAATCGCACCTTATGTGAGCGGATAACAAG-3' Bottom strand 5'-CTTGTTATCCGCTCACAATTCCACACTAATAACGAGCCGGAAGCATAAAG TGTAAAGCCTTTTTTGCCTAAAATGTGATCTAGATCACATTTATTGCG-3'
Scientific Name of Species	unidentified
NCBI taxonomy	32644
Class	DNA
Structure	OTHER
Synthetic	Yes
Component #3: protein - RNAP
Scientific name	RNA polymerase holoenzyme (sigma70)
Common Name	RNAP
Theoretical Mass	0.46 MDa
Details	Six subunits include alphaI (RpoA), alphaII (RpoA), beta (RpoB), beta prime (RpoC) with C-terminal 6His-tag, omega (RpoZ), and sigma70.
Oligomeric Details	heterohexamer
Number of Copies	1
Scientific Name of Species	Escherichia coli
Common Name of Species	Escherichia coli
NCBI taxonomy	562
Strain	K12
Recombinant expression	Yes
Engineered Source	Vector: pEcABC-H6, pRSFduet-sigma, pCDF-omega NCBI taxonomy: 469008 Expression system: Escherichia coli BL21(DE3)
Links	Gene Ontology: GO:0006351

Experiment
Sample Preparation
Staining	Sample and 2% uranyl formate stain were applied to the grid in rapid succession, with the last drop of stain remaining on the sample for 1 minute. The grid was then submerged in stain and brought up under thin carbon to form an upper sandwich layer. The grid was then blotted and dried for 10 minutes.
Specimen Conc	6.18 mg/ml
Specimen Support Details	400-mesh copper 2.0x0.5 hole pattern C-flat grid covered with thin layer of continuous carbon
Specimen State	particle
Buffer	Details: 25mM HEPES, 100mM KCl, 10mM MgCl2, 1mM DTT, 0.2mM cAMP pH: 8
Vitrification
Cryogen Name	NONE
Instrument	NONE
Imaging
Microscope	FEI TECNAI F20
Date	04-NOV-2008
Details	15 um pixel size on detector
Electron Gun
Electron Source	FIELD EMISSION GUN
Accelerating Voltage	120 kV
Electron Dose	16 e/A**2
Illumination Mode	FLOOD BEAM
Lens
Magnification	Nominal: 50000
Nominal Cs	2 mm
Imaging Mode	BRIGHT FIELD
Defocus	500 nm - 1500 nm
Specimen Holder
Holder	standard side-entry room-temperature stage
Model	SIDE ENTRY, EUCENTRIC
Temperature	293 K
Camera
Detector	Teitz F415 4k x 4k pixel CCD camera
Image Acquisition
Number of Digital Images	349

Processing
Method	single particle reconstruction
3D reconstruction
Algorithm	projection matching
Software	EMAN, SPIDER
CTF Correction	ACE
Details	EMAN interleaved with SPIDER correspondence analysis
Resolution By Author	19.8 A
Resolution Method	FSC at 0.5 cut-off
Single Particle
Number of Class Averages	280
Number of Projections	14097
Details	32816 particles were automatically selected by the Appion DoGpicker initially
Atomic Model Fitting
Model #0
Refinement Space	REAL
Software	Chimera, Yup.scx
Target Criteria	map-derived potential energy
Details	Protocol: rigid body, Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement Protocol	rigid body
PDB Entry ID	1LB2 PDB-1lb2
Model #1
Refinement Space	REAL
Details	Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Software	Chimera, Yup.scx
Refinement Protocol	rigid body
Target Criteria	map-derived potential energy
PDB Entry ID	1BDF PDB-1bdf
Model #2
Refinement Protocol	rigid body
Target Criteria	map-derived potential energy
Details	Protocol: manual fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement Space	REAL
Software	Chimera, Yup.scx
PDB Entry ID	2AUK PDB-2auk
PDB Chain ID	A
Model #3
Refinement Protocol	rigid body
Target Criteria	map-derived potential energy
Details	Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement Space	REAL
Software	Chimera, Yup.scx
PDB Entry ID	1SIG PDB-1sig
PDB Chain ID	A
Model #4
Details	Protocol: rigid body fit followed by Yup.scx simulated annealing. A complete ternary complex model was generated using multiple PDB entries, with a homology modelling step for RNAP. The model was regularized with PHENIX and the refined against the EM map with Yup.scx using default parameters.
Refinement Protocol	rigid body
Refinement Space	REAL
Software	Chimera, Modeller, Yup.scx
Target Criteria	map-derived potential energy
PDB Entry ID	3DXJ PDB-3dxj
Fitted Coordinate
PDB entry ID	PDB-3iyd